RARRES1 (NM_002888) Human 3' UTR Clone

CAT#: SC201033

3' UTR clone of retinoic acid receptor responder (tazarotene induced) 1 (RARRES1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RARRES1 (NM_002888) Human 3' UTR Clone
Vector pMirTarget
Synonyms LXNL; PERG-1; TIG1
ACCN NM_002888
Insert Size 155 bp
Sequence Data
>SC201033 3’UTR clone of NM_002888
The sequence shown below is from the reference sequence of NM_002888. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGTGTGAGGCAGTGGGTAAGAAAAACCTGAAAATTAACTTGTGCCACAAGAGTTACAATCAAAGTGGTC
TCCTTAGACTGAATTCATGCGAACTTCTAATTTCATATCAAGAGTTGTAATCACATTTATTTCAATAAA
TATGTGAGTTCCTGCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002888.4
Synonyms LXNL; PERG-1; TIG1
Summary This gene was identified as a retinoid acid (RA) receptor-responsive gene. It encodes a type 1 membrane protein. The expression of this gene is upregulated by tazarotene as well as by retinoic acid receptors. The expression of this gene is found to be downregulated in prostate cancer, which is caused by the methylation of its promoter and CpG island. Alternatively spliced transcript variant encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Locus ID 5918
MW 6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...