Aminoacylase 1 (ACY1) (NM_000666) Human 3' UTR Clone

CAT#: SC201030

3' UTR clone of aminoacylase 1 (ACY1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Aminoacylase 1 (ACY1) (NM_000666) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACY-1; ACY1D; HEL-S-5
ACCN NM_000666
Insert Size 152 bp
Sequence Data
>SC201030 3’UTR clone of NM_000666
The sequence shown below is from the reference sequence of NM_000666. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGTGTGCCTGCCCTGCCCAGTGACAGCTGAGCCCTGGAACTCCTAAACCTTTGCCCCTGGGGCTTCCAT
CCCAACCAGTGCCAAGGACCTCCTCTTCCCCCTTCCAAATAATAAAGTCTATGGACAGGGCTGTCTCTG
AAGTACTAACACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000666.3
Synonyms ACY-1; ACY1D; HEL-S-5
Summary This gene encodes a cytosolic, homodimeric, zinc-binding enzyme that catalyzes the hydrolysis of acylated L-amino acids to L-amino acids and an acyl group, and has been postulated to function in the catabolism and salvage of acylated amino acids. This gene is located on chromosome 3p21.1, a region reduced to homozygosity in small-cell lung cancer (SCLC), and its expression has been reported to be reduced or undetectable in SCLC cell lines and tumors. The amino acid sequence of human aminoacylase-1 is highly homologous to the porcine counterpart, and this enzyme is the first member of a new family of zinc-binding enzymes. Mutations in this gene cause aminoacylase-1 deficiency, a metabolic disorder characterized by central nervous system defects and increased urinary excretion of N-acetylated amino acids. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ABHD14A (abhydrolase domain containing 14A) gene, as represented in GeneID:100526760. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Nov 2010]
Locus ID 95
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...