beta Defensin 1 (DEFB1) (NM_005218) Human 3' UTR Clone

CAT#: SC201014

3' UTR clone of defensin beta 1 (DEFB1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name beta Defensin 1 (DEFB1) (NM_005218) Human 3' UTR Clone
Vector pMirTarget
Synonyms BD1; DEFB-1; DEFB101; HBD1
ACCN NM_005218
Insert Size 119 bp
Sequence Data
>SC201014 3’UTR clone of NM_005218
The sequence shown below is from the reference sequence of NM_005218. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACAGAGGGAAGGCCAAGTGCTGCAAGTGAGCTGGGAGTGACCAGAAGAAATGACGCAGAAGTGAAATG
AACTTTTTATAAGCATTCTTTTAATAAAGGAAAATTGCTTTTGAAGTATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005218.4
Synonyms BD1; DEFB-1; DEFB101; HBD1
Summary Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 1, an antimicrobial peptide implicated in the resistance of epithelial surfaces to microbial colonization. This gene maps in close proximity to defensin family member, defensin, alpha 1 and has been implicated in the pathogenesis of cystic fibrosis. [provided by RefSeq, Jul 2008]
Locus ID 1672
MW 4.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...