Myosin Heavy chain 1 (MYH1) (NM_005963) Human 3' UTR Clone

CAT#: SC200985

3' UTR clone of myosin heavy chain 1 skeletal muscle adult (MYH1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Myosin Heavy chain 1 (MYH1) (NM_005963) Human 3' UTR Clone
Vector pMirTarget
Synonyms HEL71; MYHa; MyHC-2x; MyHC-2X/D; MYHSA1
ACCN NM_005963
Insert Size 139 bp
Sequence Data
>SC200985 3’UTR clone of NM_005963
The sequence shown below is from the reference sequence of NM_005963. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTTCACACAAAAATCATAAGTGAAGAGTAATTTATCTAACTGCTGAAAGGTGACCAAAGAAATGCACAA
AATGTGAAAATCTTTGTCACTCCATTTTGTACTTATGACTTTTGGAGATAAAAAATTTATCTGCCAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005963.4
Synonyms HEL71; MYHa; MyHC-2x; MyHC-2X/D; MYHSA1
Summary Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
Locus ID 4619
MW 5.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...