FKBP2 (NM_057092) Human 3' UTR Clone

CAT#: SC200944

3' UTR clone of FK506 binding protein 2 13kDa (FKBP2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FKBP2 (NM_057092) Human 3' UTR Clone
Vector pMirTarget
Synonyms FKBP-13; FKBP13; PPIase
ACCN NM_057092
Insert Size 152 bp
Sequence Data
>SC200944 3’UTR clone of NM_057092
The sequence shown below is from the reference sequence of NM_057092. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCAAAATAGAGCGACGAACTGAGCTGTAACCAGACTGGGGAGGGGCAGGGGGAGAGGCCCCCATCAGG
GACCAGACTGTTCCAAAAAAAAAACAAAAAACAAAAACAAACAAAAAAACACTTAAAAGCCCAAGGAAA
AAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_057092.2
Synonyms FKBP-13; FKBP13; PPIase
Summary The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]
Locus ID 2286
MW 5.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...