RPL36AL (NM_001001) Human 3' UTR Clone

CAT#: SC200943

3' UTR clone of ribosomal protein L36a-like (RPL36AL) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RPL36AL (NM_001001) Human 3' UTR Clone
Vector pMirTarget
Synonyms RPL36A
ACCN NM_001001
Insert Size 284 bp
Sequence Data
>SC200943 3’UTR clone of NM_001001
The sequence shown below is from the reference sequence of NM_001001. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAGAAAGGGCCAAGTGATCCAGTTCTAAACTTTGGGATATTTTTCTTCAATTTTGAAGAGAAAATGG
TGAAGCCATAGAAAAGTTACCCGAGGGAAAATAAATACAGTGATATTCTTACGCAAACTTTTTGTGGTT
TTTACTTATAAATAGAATTCCATGTTTAGTGTAGTCCCACCTCAAACTTTACTAACAAGTTTATATATG
TATGAAGGGAAAATACTACTTTACTACTTTTTGTTTTCTGGTCAATTTCAAATGTTGAATGAATTCATA
AACATTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001001.5
Synonyms RPL36A
Summary Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which shares sequence similarity with yeast ribosomal protein L44, belongs to the L44E (L36AE) family of ribosomal proteins. This gene and the human gene officially named ribosomal protein L36a (RPL36A) encode nearly identical proteins; however, they are distinct genes. Although the name of this gene has been referred to as ribosomal protein L36a (RPL36A), its official name is ribosomal protein L36a-like (RPL36AL). As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Locus ID 6166
MW 11.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...