Laminin beta 2 (LAMB2) (NM_002292) Human 3' UTR Clone

CAT#: SC200938

3' UTR clone of laminin beta 2 (laminin S) (LAMB2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Laminin beta 2 (LAMB2) (NM_002292) Human 3' UTR Clone
Vector pMirTarget
Synonyms LAMS; NPHS5
ACCN NM_002292
Insert Size 142 bp
Sequence Data
>SC200938 3’UTR clone of NM_002292
The sequence shown below is from the reference sequence of NM_002292. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGTGCAGATCTACAACACCTGCCAGTGACCCCTGCCCAAGGCCTACCCCAGTTCCTAGCACTGCCCC
ACATGCATGTCTGCCTATGCACTGAAGAGCTCTTGGCCCGGCAGGGCCCCCAATAAACCAGTGTGAACC
CCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002292.4
Synonyms LAMS; NPHS5
Summary Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
Locus ID 3913
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...