Iba1 (AIF1) (NM_001623) Human 3' UTR Clone

CAT#: SC200928

3' UTR clone of allograft inflammatory factor 1 (AIF1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Iba1 (AIF1) (NM_001623) Human 3' UTR Clone
Vector pMirTarget
Synonyms AIF-1; IBA1; IRT-1; IRT1
ACCN NM_001623
Insert Size 145 bp
Sequence Data
>SC200928 3’UTR clone of NM_001623
The sequence shown below is from the reference sequence of NM_001623. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCAAGAAAGCTATCTCTGAGTTGCCCTGATTTGAAGGGAAAAGGGATGATGGGATTGAAGGGGCTTCT
AATGACCCAGATATGGAAACAGAAGACAAAATTGTAAGCCAGAGTCAACAAATTAAATAAATTACCCCC
TCCTCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001623.5
Synonyms AIF-1; IBA1; IRT-1; IRT1
Summary This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain. [provided by RefSeq, Jan 2016]
Locus ID 199
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...