Biliverdin Reductase (BLVRA) (NM_000712) Human 3' UTR Clone

CAT#: SC200917

3' UTR clone of biliverdin reductase A (BLVRA) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Biliverdin Reductase (BLVRA) (NM_000712) Human 3' UTR Clone
Vector pMirTarget
Synonyms BLVR; BVR; BVRA
ACCN NM_000712
Insert Size 137 bp
Sequence Data
>SC200917 3’UTR clone of NM_000712
The sequence shown below is from the reference sequence of NM_000712. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCCAGAAATATTGCTGTTCAAGGAAGTAAGAGGAGGAGGTGATGTAGCACTTCCAAGATGGCACCAGC
ATTTGGTTCTTCTCAAGAGTTGACCATTATCTCTATTCTTAAAATTAAACATGTTGGGGAAACAAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000712.4
Synonyms BLVR; BVR; BVRA
Summary The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Locus ID 644
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...