BAT3 (BAG6) (NM_001098534) Human 3' UTR Clone

CAT#: SC200912

3' UTR clone of HLA-B associated transcript 3 (BAT3) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BAT3 (BAG6) (NM_001098534) Human 3' UTR Clone
Vector pMirTarget
Synonyms BAG-6; BAT3; D6S52E; G3
ACCN NM_001098534
Insert Size 133 bp
Sequence Data
>SC200912 3’UTR clone of NM_001098534
The sequence shown below is from the reference sequence of NM_001098534. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCCAGCGGGCCTTTGCTGATGATCCTTAGCTCTTTGCTCTATGGCCCTTCCTCATCAGGGGACCGTTT
CCCCCCTCTTCCTTCACAGTATTTAAGAAATAAAAGTCGGATTTTTCTGGCTGCTTTCTCTCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001098534.2
Synonyms BAG-6; BAT3; D6S52E; G3
Summary This gene was first characterized as part of a cluster of genes located within the human major histocompatibility complex class III region. This gene encodes a nuclear protein that is cleaved by caspase 3 and is implicated in the control of apoptosis. In addition, the protein forms a complex with E1A binding protein p300 and is required for the acetylation of p53 in response to DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 7917
MW 5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...