S100A12 (NM_005621) Human 3' UTR Clone

CAT#: SC200909

3' UTR clone of S100 calcium binding protein A12 (S100A12) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name S100A12 (NM_005621) Human 3' UTR Clone
Vector pMirTarget
Synonyms CAAF1; CAGC; CGRP; ENRAGE; MRP-6; MRP6; p6
ACCN NM_005621
Insert Size 146 bp
Sequence Data
>SC200909 3’UTR clone of NM_005621
The sequence shown below is from the reference sequence of NM_005621. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGCCCATTACCACACCCACAAAGAGTAGGTAGCTCTCTGAAGGCTTTTTACCCAGCAATGTCCTCAA
TGAGGGTCTTTTCTTTCCCTCACCAAAACCCAGCCTTGCCCGTGGGGAGTAAGAGTTAATAAACACACT
CACGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005621.2
Synonyms CAAF1; CAGC; CGRP; ENRAGE; MRP-6; MRP6; p6
Summary The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein is proposed to be involved in specific calcium-dependent signal transduction pathways and its regulatory effect on cytoskeletal components may modulate various neutrophil activities. The protein includes an antimicrobial peptide which has antibacterial activity. [provided by RefSeq, Nov 2014]
Locus ID 6283
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...