Apolipoprotein H (APOH) (NM_000042) Human 3' UTR Clone

CAT#: SC200902

3' UTR clone of apolipoprotein H (beta-2-glycoprotein I) (APOH) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Apolipoprotein H (APOH) (NM_000042) Human 3' UTR Clone
Vector pMirTarget
Synonyms B2G1; B2GP1; BG
ACCN NM_000042
Insert Size 130 bp
Sequence Data
>SC200902 3’UTR clone of NM_000042
The sequence shown below is from the reference sequence of NM_000042. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTGATGCATCCGATGTAAAGCCATGCTAAGGTGGTTTTCAGATTCCACACAAAATGTCACACTTGTTT
CTTGTTCATCCAAGGAACCTAATTGAAATTTAAAAATAAAGCTACTGAATTTATTGCCGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000042.3
Synonyms B2G1; B2GP1; BG
Summary Apolipoprotein H, also known as beta-2-glycoprotein I, is a component of circulating plasma lipoproteins. It has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, hemostasis, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome (APS). The anti-beta (2) glycoprotein I antibodies from APS patients, mediate inhibition of activated protein C which has anticoagulant properties. Because beta-2-GPI is the main autoantigen in patients with APS, the disruption of this pathway by autoantibodies may be an important mechanism for thrombosis in patients with APS.[provided by RefSeq, Dec 2019]
Locus ID 350
MW 5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...