Miz1 (ZBTB17) (NM_003443) Human 3' UTR Clone

CAT#: SC200875

3' UTR clone of zinc finger and BTB domain containing 17 (ZBTB17) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Miz1 (ZBTB17) (NM_003443) Human 3' UTR Clone
Vector pMirTarget
Synonyms MIZ-1; pHZ-67; ZNF60; ZNF151
ACCN NM_003443
Insert Size 130 bp
Sequence Data
>SC200875 3’UTR clone of NM_003443
The sequence shown below is from the reference sequence of NM_003443. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTCCTGAATGTCCCCCGCCTGCCGAGTGAGCTGGCGGCCCTTCTGACTGTTTATTTAAGGATGGATGG
CACCCTGGAACCGGGAAGGGTGGCCTGTTCCCTAGAGAGAATAAATTGGATTATTTTCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003443.3
Synonyms MIZ-1; pHZ-67; ZNF60; ZNF151
Summary This gene encodes a zinc finger protein involved in the regulation of c-myc. The symbol MIZ1 has also been associated with PIAS2 which is a different gene located on chromosome 18. [provided by RefSeq, Jul 2008]
Locus ID 7709
MW 4.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...