ST2 (IL1RL1) (NM_016232) Human 3' UTR Clone

CAT#: SC200870

3' UTR clone of interleukin 1 receptor-like 1 (IL1RL1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ST2 (IL1RL1) (NM_016232) Human 3' UTR Clone
Vector pMirTarget
Synonyms DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1
ACCN NM_016232
Insert Size 146 bp
Sequence Data
>SC200870 3’UTR clone of NM_016232
The sequence shown below is from the reference sequence of NM_016232. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGACTCCCTTGGCTGCCCAGAAGCAATAGTGCCTGCTGTGATGTGCAAAGGCATCTGAGTTTGAAGCT
TTCCTGACTTCTCCTAGCTGGCTTATGCCCCTGCACTGAAGTGTGAGGAGCAGGAATATTAAAGGGATT
CAGGCCTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016232.5
Synonyms DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1
Summary The protein encoded by this gene is a member of the interleukin 1 receptor family. Studies of the similar gene in mouse suggested that this receptor can be induced by proinflammatory stimuli, and may be involved in the function of helper T cells. This gene, interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2) and interleukin 1 receptor-like 2 (IL1RL2) form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Locus ID 9173
MW 5.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...