RO60 (NM_001042370) Human 3' UTR Clone

CAT#: SC200865

3' UTR clone of TROVE domain family member 2 (TROVE2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RO60 (NM_001042370) Human 3' UTR Clone
Vector pMirTarget
Synonyms RORNP; SSA2; TROVE2
ACCN NM_001042370
Insert Size 146 bp
Sequence Data
>SC200865 3’UTR clone of NM_001042370
The sequence shown below is from the reference sequence of NM_001042370. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTCTGGATCCTTGCAAAATACCCTACTAAATAAATCATTTTAGACATGGAGTGCAGGTGGACACTGTG
TGAACTGTTTTTGGTCAGTTATTGTAGAAATTGATAGATGTACCAAATAAACTCTATGCACATTAAAAA
AAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001042370.2
Synonyms RORNP; SSA2; TROVE2
Summary RNA-binding protein that binds to misfolded non-coding RNAs, pre-5S rRNA, and several small cytoplasmic RNA molecules known as Y RNAs. May stabilize some of these RNAs and protect them from degradation (PubMed:18056422). Binds to endogenous Alu retroelements which are induced by type I interferon and stimulate porinflammaotry cytokine secretion. Regulates the expression of Alu retroelements as well as inflammatory genes (PubMed:26382853).[UniProtKB/Swiss-Prot Function]
Locus ID 6738
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...