HSD17B2 (NM_002153) Human 3' UTR Clone

CAT#: SC200858

3' UTR clone of hydroxysteroid (17-beta) dehydrogenase 2 (HSD17B2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HSD17B2 (NM_002153) Human 3' UTR Clone
Vector pMirTarget
Synonyms EDH17B2; HSD17; SDR9C2
ACCN NM_002153
Insert Size 128 bp
Sequence Data
>SC200858 3’UTR clone of NM_002153
The sequence shown below is from the reference sequence of NM_002153. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGCCTAACTACAAGAAAAAGGCCACCTAGGCAATGGAAGCCCTCAAAGAAGTCGGAATGTCATAGTCT
TGAAATGAAAGGGAAACTGGGAAACTGGGTTTCTCATTAAAGTTGTTTCCCACTCTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002153.3
Synonyms EDH17B2; HSD17; SDR9C2
Summary Capable of catalyzing the interconversion of testosterone and androstenedione, as well as estradiol and estrone. Also has 20-alpha-HSD activity. Uses NADH while EDH17B3 uses NADPH.[UniProtKB/Swiss-Prot Function]
Locus ID 3294
MW 4.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...