MLC1SA (MYL6B) (NM_002475) Human 3' UTR Clone

CAT#: SC200854

3' UTR clone of myosin light chain 6B alkali smooth muscle and non-muscle (MYL6B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MLC1SA (MYL6B) (NM_002475) Human 3' UTR Clone
Vector pMirTarget
Synonyms MLC1SA
ACCN NM_002475
Insert Size 140 bp
Sequence Data
>SC200854 3’UTR clone of NM_002475
The sequence shown below is from the reference sequence of NM_002475. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCTTCTTGAAACACATCCTAAGCGTCTGAGTGCTGCAGATCCAGTGGGGTCCGGACACTGGGCCCCGC
AGGCGAAAGCACGTTCCAGCCACCAGGAGGCCACCTATTGTTTCAAAATAAAGACTGGGTTCCTCTCTT
GG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002475.5
Synonyms MLC1SA
Summary Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in both slow-twitch skeletal muscle and in nonmuscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Locus ID 140465
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...