JNK1 (MAPK8) (NM_139047) Human 3' UTR Clone

CAT#: SC200789

3' UTR clone of mitogen-activated protein kinase 8 (MAPK8) transcript variant JNK1-b2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name JNK1 (MAPK8) (NM_139047) Human 3' UTR Clone
Vector pMirTarget
Synonyms JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c
ACCN NM_139047
Insert Size 141 bp
Sequence Data
>SC200789 3’UTR clone of NM_139047
The sequence shown below is from the reference sequence of NM_139047. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCAGCTGGGCCTCTGGGCTGCTGTAGATGACTACTTGGGCCATCGGGGGGTGGGAGGGATGGGGAGTCG
GTTAGTCATTGATAGAACTACTTTGAAAACAATTCAGTGGTCTTATTTTTGGGTGATTTTTCAAAAAAT
GTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_139047.1
Synonyms JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c
Summary The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]
Locus ID 5599
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...