CACNB1 (NM_199248) Human 3' UTR Clone

CAT#: SC200771

3' UTR clone of calcium channel voltage-dependent beta 1 subunit (CACNB1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CACNB1 (NM_199248) Human 3' UTR Clone
Vector pMirTarget
Synonyms CAB1; CACNLB1; CCHLB1
ACCN NM_199248
Insert Size 139 bp
Sequence Data
>SC200771 3’UTR clone of NM_199248
The sequence shown below is from the reference sequence of NM_199248. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGCCCCAGGAGCAGGAACATGCCATGTAGTGGGCGCCCTGCCCGTCTTCCCTCCTGCTCTGGGGTCGG
AACTGGAGTGCAGGGAACATGGAGGAGGAAGGGAAGAGCTTTATTTTGTAAAAAAATAAGATGAGCGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_199248.3
Synonyms CAB1; CACNLB1; CCHLB1
Summary The protein encoded by this gene belongs to the calcium channel beta subunit family. It plays an important role in the calcium channel by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 782
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...