SUR1 (ABCC8) (NM_000352) Human 3' UTR Clone

CAT#: SC200738

3' UTR clone of ATP-binding cassette sub-family C (CFTR/MRP) member 8 (ABCC8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SUR1 (ABCC8) (NM_000352) Human 3' UTR Clone
Vector pMirTarget
Synonyms ABC36; HHF1; HI; HRINS; MRP8; PHHI; PNDM3; SUR; SUR1; SUR1delta2; TNDM2
ACCN NM_000352
Insert Size 136 bp
Sequence Data
>SC200738 3’UTR clone of NM_000352
The sequence shown below is from the reference sequence of NM_000352. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCGCCTCCTTCGTCCGTGCAGACAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTG
CCCATACCCCTGCCTGGGTTTTCTAACTGTAAATCACTTGTAAATAAATAGATTTGATTATTTCCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000352.6
Synonyms ABC36; HHF1; HI; HRINS; MRP8; PHHI; PNDM3; SUR; SUR1; SUR1delta2; TNDM2
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations in the ABCC8 gene and deficiencies in the encoded protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2020]
Locus ID 6833
MW 5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...