Growth Hormone (GH1) (NM_022561) Human 3' UTR Clone

CAT#: SC200713

3' UTR clone of growth hormone 1 (GH1) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Growth Hormone (GH1) (NM_022561) Human 3' UTR Clone
Vector pMirTarget
Synonyms GH; GH-N; GHN; hGH-N; IGHD1B
ACCN NM_022561
Insert Size 136 bp
Sequence Data
>SC200713 3’UTR clone of NM_022561
The sequence shown below is from the reference sequence of NM_022561. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCTCTGTGGAGGGCAGCTGTGGCTTCTAGCTGCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCT
CTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022561.2
Synonyms GH; GH-N; GHN; hGH-N; IGHD1B
Summary The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. The five genes share a remarkably high degree of sequence identity. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed in the pituitary but not in placental tissue as is the case for the other four genes in the growth hormone locus. Mutations in or deletions of the gene lead to growth hormone deficiency and short stature. [provided by RefSeq, Jul 2008]
Locus ID 2688
MW 4.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...