PNMT (NM_002686) Human 3' UTR Clone

CAT#: SC200698

3' UTR clone of phenylethanolamine N-methyltransferase (PNMT) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PNMT (NM_002686) Human 3' UTR Clone
Vector pMirTarget
Synonyms PENT; PNMTase
ACCN NM_002686
Insert Size 116 bp
Sequence Data
>SC200698 3’UTR clone of NM_002686
The sequence shown below is from the reference sequence of NM_002686. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCGCCTGGGCTCAGAAGGTTGGGCTGTGAGGGCTGTACCTGGTGCCCTGTGGCCCCCACCCACCTGGA
TTCCCTGTTCTTTGAAGTGGCACCTAATAAAGAAATAATACCCTGCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002686.4
Synonyms PENT; PNMTase
Summary The product of this gene catalyzes the last step of the catecholamine biosynthesis pathway, which methylates norepinephrine to form epinephrine (adrenaline). The enzyme also has beta-carboline 2N-methyltransferase activity. This gene is thought to play a key step in regulating epinephrine production. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2012]
Locus ID 5409
MW 4.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...