RNF31 (NM_017999) Human 3' UTR Clone

CAT#: SC200657

3' UTR clone of ring finger protein 31 (RNF31) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RNF31 (NM_017999) Human 3' UTR Clone
Vector pMirTarget
Synonyms HOIP; Paul; ZIBRA
ACCN NM_017999
Insert Size 112 bp
Sequence Data
>SC200657 3’UTR clone of NM_017999
The sequence shown below is from the reference sequence of NM_017999. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGACAGAGTATCCCCCGCAGGCGGAAGTAGCTGAGGGCAAGGGTCCCGATGAGGGTCCCATGGCCTGCT
CCCTCAGGAACAGCTCCAGCACCAATAAAGAGGCATCTTACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017999.5
Synonyms HOIP; Paul; ZIBRA
Summary The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
Locus ID 55072
MW 4.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...