Cbl c (CBLC) (NM_012116) Human 3' UTR Clone

CAT#: SC200653

3' UTR clone of Cas-Br-M (murine) ecotropic retroviral transforming sequence c (CBLC) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cbl c (CBLC) (NM_012116) Human 3' UTR Clone
Vector pMirTarget
Synonyms CBL-3; CBL-SL; RNF57
ACCN NM_012116
Insert Size 139 bp
Sequence Data
>SC200653 3’UTR clone of NM_012116
The sequence shown below is from the reference sequence of NM_012116. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGGACCCCAGGACCCTGCCCCGGCCTGAAGGCCAGGGCACCCAGATGTGCTGCTCAAGGGAGCCCCA
AGGGCTGGAAGGGGGTTGTGAAACCGAAATAAACTGCCAAGCCTGGTCTGTCCTCCAGGGTGCAAAGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012116.4
Synonyms CBL-3; CBL-SL; RNF57
Summary This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Locus ID 23624
MW 4.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...