SSBP1 (NM_003143) Human 3' UTR Clone

CAT#: SC200652

3' UTR clone of single-stranded DNA binding protein 1 (SSBP1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SSBP1 (NM_003143) Human 3' UTR Clone
Vector pMirTarget
Synonyms Mt-SSB; mtSSB; SOSS-B1; SSBP
ACCN NM_003143
Insert Size 164 bp
Sequence Data
>SC200652 3’UTR clone of NM_003143
The sequence shown below is from the reference sequence of NM_003143. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGAGTGACCAGACGAAAGAGAAGGAGTAGAAAGGATGATTCTTCTTTGGCCATCATTTGGTACAGTCT
CATTTCCAAGTCATGTATAATCTTTATGGCTTCCAAGGACAAGAATTAAAATACTCTTTTACGTAAAAT
GAGTAATAATCTTTTTTCTGACTGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003143.3
Synonyms Mt-SSB; mtSSB; SOSS-B1; SSBP
Summary SSBP1 is a housekeeping gene involved in mitochondrial biogenesis (Tiranti et al., 1995 [PubMed 7789991]). It is also a subunit of a single-stranded DNA (ssDNA)-binding complex involved in the maintenance of genome stability (Huang et al., 2009) [PubMed 19683501].[supplied by OMIM, Feb 2010]
Locus ID 6742
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...