SSC5D (NM_001144950) Human 3' UTR Clone

CAT#: SC200627

3' UTR clone of scavenger receptor cysteine-rich glycoprotein (SSC5D) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SSC5D (NM_001144950) Human 3' UTR Clone
Vector pMirTarget
Synonyms S5D-SRCRB
ACCN NM_001144950
Insert Size 131 bp
Sequence Data
>SC200627 3’UTR clone of NM_001144950
The sequence shown below is from the reference sequence of NM_001144950. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGAAAGACCCCTGAGGGGAGACGTGTGACCCTCTCCAGGATTTGAGGGGCTTAAGACACCCCCAACC
AAAAAAAACAAAAACAAAAAAAACCCCCAAAGTATCTAATTAAAAACAAGGTGTGAATGGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001144950.2
Synonyms S5D-SRCRB
Summary Binds to extracellular matrix proteins. Binds to pathogen-associated molecular patterns (PAMPs) present on the cell walls of Gram-positive and Gram-negative bacteria and fungi, behaving as a pattern recognition receptor (PRR). Induces bacterial and fungal aggregation and subsequent inhibition of PAMP-induced cytokine release. Does not possess intrinsic bactericidal activity. May play a role in the innate defense and homeostasis of certain epithelial surfaces (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 284297
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...