TUBA3D (NM_080386) Human 3' UTR Clone

CAT#: SC200614

3' UTR clone of tubulin alpha 3d (TUBA3D) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TUBA3D (NM_080386) Human 3' UTR Clone
Vector pMirTarget
Synonyms H2-ALPHA; KTCN9; TUBA2
ACCN NM_080386
Insert Size 116 bp
Sequence Data
>SC200614 3’UTR clone of NM_080386
The sequence shown below is from the reference sequence of NM_080386. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGAGGCTGAAGAAGGCGAAGAATACTGAGGGGAGGGTGTGGTGGGTTCTCCCCTGCCACCCCCGGGA
TGGCTGCTTCCAAGTTGTTTGCAATTAAAGGTTCTGTATAAAACCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_080386.4
Synonyms H2-ALPHA; KTCN9; TUBA2
Summary This gene encodes a member of the alpha tubulin family. Tubulin is a major component of microtubules, which are composed of alpha- and beta-tubulin heterodimers and microtubule-associated proteins in the cytoskeleton. Microtubules maintain cellular structure, function in intracellular transport, and play a role in spindle formation during mitosis. [provided by RefSeq, Oct 2011]
Locus ID 113457
MW 4.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...