TUBA3E (NM_207312) Human 3' UTR Clone

CAT#: SC200609

3' UTR clone of tubulin alpha 3e (TUBA3E) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TUBA3E (NM_207312) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_207312
Insert Size 116 bp
Sequence Data
>SC200609 3’UTR clone of NM_207312
The sequence shown below is from the reference sequence of NM_207312. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGAGGCTGAAGAAGGCGAAGCATACTGAGGGGAGGGTGTGGTGGGTTCTCCCCTGCCACCCCTAGGA
TGGCTGCTTTCAAGTTGTTTGCAATTAAAGATTCTGTATAAAACCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_207312.3
Summary Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. This gene encodes an alpha tubulin that highly conserved among species. A missense mutation in this gene has been potentially linked to microlissencephaly and global developmental delay. [provided by RefSeq, Jul 2016]
Locus ID 112714
MW 4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...