Dopamine Receptor D4 (DRD4) (NM_000797) Human 3' UTR Clone

CAT#: SC200608

3' UTR clone of dopamine receptor D4 (DRD4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Dopamine Receptor D4 (DRD4) (NM_000797) Human 3' UTR Clone
Vector pMirTarget
Synonyms D4DR
ACCN NM_000797
Insert Size 133 bp
Sequence Data
>SC200608 3’UTR clone of NM_000797
The sequence shown below is from the reference sequence of NM_000797. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCCGCAAGGCCCTGCGTGCCTGCTGCTGAGCCGGGCACCCCCGGACGCCCCCCGGCCTGATGGCCAGG
CCTCAGGGACCAAGGAGATGGGGAGGGCGCTTTTGTACGTTAATTAAACAAATTCCTTCCCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000797.4
Synonyms D4DR
Summary This gene encodes the D4 subtype of the dopamine receptor. The D4 subtype is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs which treat schizophrenia and Parkinson disease. Mutations in this gene have been associated with various behavioral phenotypes, including autonomic nervous system dysfunction, attention deficit/hyperactivity disorder, and the personality trait of novelty seeking. This gene contains a polymorphic number (2-10 copies) of tandem 48 nt repeats; the sequence shown contains four repeats. [provided by RefSeq, Jul 2008]
Locus ID 1815
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...