PQBP1 (NM_005710) Human 3' UTR Clone

CAT#: SC200539

3' UTR clone of polyglutamine binding protein 1 (PQBP1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PQBP1 (NM_005710) Human 3' UTR Clone
Vector pMirTarget
Synonyms MRX2; MRX55; MRXS3; MRXS8; NPW38; RENS1; SHS
ACCN NM_005710
Insert Size 125 bp
Sequence Data
>SC200539 3’UTR clone of NM_005710
The sequence shown below is from the reference sequence of NM_005710. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGCCTCCCGAACCAAGCAGCAGGATTGAAGCTTCGGCCTCCCTGGCCCTGGGTTAAAATAAAAGCTT
TCTGGTGATCCTGCCCACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005710.2
Synonyms MRX2; MRX55; MRXS3; MRXS8; NPW38; RENS1; SHS
Summary This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]
Locus ID 10084
MW 4.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...