C6orf150 (MB21D1) (NM_138441) Human 3' UTR Clone

CAT#: SC200522

3' UTR clone of chromosome 6 open reading frame 150 (C6orf150) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name C6orf150 (MB21D1) (NM_138441) Human 3' UTR Clone
Vector pMirTarget
Synonyms C6orf150; h-cGAS; MB21D1
ACCN NM_138441
Insert Size 1546 bp
Sequence Data
>SC200522 3’UTR clone of NM_138441
The sequence shown below is from the reference sequence of NM_138441. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATGAGTTTCCAGTTTTTGATGAATTTTGAGATTGTATTTTTAGAAAGATCTAAGAACTAGAGTCACCC
TAAATCCTGGAGAATACAAGAAAAATTTGAAAAGGGGCCAGACGCTGTGGCTCACACCTGTAATCCCAG
CTCTTTGGAGGCCGAGGCAGGCGGATCACTTGAGGTCAGGAGTTTGAGACCAGCCTGACCAACATGGTG
AAACTCCATCTCTACTAAAAATATAAAAATTAGCCGGGCATGGTGATGCATGCCTGTAATCCCAGCTAC
TCGGGAGGCTTAGACATGAGAATCACTTGAACCCAGGAGGTGGAGGTTGCAGTGAGTCAAGATGGCACC
ACTGCACTCCATCCTGGGTGACAGAGCAAGACTTCCTCTCAAAAAATAAATAAATAAATAAGAAAAATA
AATTAGGAAATTATTAAAATAATTTTTTAGAAAAGCAACAAAATAACAAAAATTAGTGACTGTAATAAT
TGGAATGTTTGAAATTTGTCACAGCAATAATTGACTAAAATGAATGTAAATAATTATTCAGTTTTCAGT
TTGTTGTAATAAACTCTAATCAGTATAAAGGATTGACTATCCTAGGAAAAAGATTAGTCAAGGAATAAG
AAGCAAAAGTAGTATTTGAAATCTAAAAACATTACCATGTTTGCTTTATCATGCAGGCAAATAAATAAA
TAAATGACATTTTTAGGTTGGAATAAAAAAAGATAAAGTACATATTGCCTTAATTAAATTCATCAAGTT
CTTACTGAAAAACAGCTCTCCGCCGTGCCTGGCCAGGAAATACATAATTTTTTTTTTTTTTTTTTAGAT
GGAGTCTCGCTCTGTCGCCCAGGCTGGAGTCCAGTGGCATGATCTTGGCTCACTGCAAGCTCTGCTTCC
TGGGTTCATGCCATTCTCCTGCCTCAGCCTTCCGAGTAGCTGGGACTACAGGTGCCCGCCACCACATCC
GGCTAATTTTTTGTATTTTTAGTAAAGATGGGGTTTCACCATGTTAGCCAGGATGGTCTCGATCTCCTT
ACCTTGTGATCCGCCCGCCTTGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCACGCCTGGCT
GAAATACATAATCTTAAAAGAAAACATAAGATACTTTATTTTAATATACGTGACTAAATGTAAAACCTA
ACTTATTTTCTGTTATCTATTTATTTTTACTTTCAGTAACACTTTTTTTATTTTAGGTAGCATTCAGCC
TAGAGGCAACTGCTGTTTGTTAAATATTTCCTGTTCATATATTTTGCACATTTTCTTATGGGTTAGTTT
TCTTCTCATTGTTTTGGGAAGTTCTTAATATATTTGGGGTATTTATCTTTCATTCGTTGTCTGTGTAAC
AAATAACTTCTGCCATATGGGTTGTCTGCACATTTTTTGGTGTCTTTTAGTAAACAAGGTTTTTTTGTT
TTGTATTGTTTTGTTTATTGTAAAGATTTTTAAATTTTAATGGAGTTGATTTCTTTTCTCATTCAAGCT
TTTGAGAATAAATTGGAGTTGAATTTTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_138441.3
Synonyms C6orf150; h-cGAS; MB21D1
Summary Nucleotidyltransferase that catalyzes the formation of cyclic GMP-AMP (cGAMP) from ATP and GTP and plays a key role in innate immunity (PubMed:23258413, PubMed:23707061, PubMed:23722159, PubMed:24077100, PubMed:25131990, PubMed:29976794, PubMed:30799039). Catalysis involves both the formation of a 2',5' phosphodiester linkage at the GpA step and the formation of a 3',5' phosphodiester linkage at the ApG step, producing c[G(2',5')pA(3',5')p] (PubMed:28363908, PubMed:28214358). Acts as a key cytosolic DNA sensor, the presence of double-stranded DNA (dsDNA) in the cytoplasm being a danger signal that triggers the immune responses (PubMed:28363908). Binds cytosolic DNA directly, leading to activation and synthesis of cGAMP, a second messenger that binds to and activates TMEM173/STING, thereby triggering type-I interferon production (PubMed:28363908, PubMed:28314590). Preferentially recognizes and binds curved long DNAs (PubMed:30007416). In contrast to other mammals, human CGAS displays species-specific mechanisms of DNA recognition and produces less cyclic GMP-AMP (cGAMP), allowing a more fine-tuned response to pathogens (PubMed:30007416). Has antiviral activity by sensing the presence of dsDNA from DNA viruses in the cytoplasm (PubMed:28363908). Also acts as an innate immune sensor of infection by retroviruses, such as HIV-1, by detecting the presence of reverse-transcribed DNA in the cytosol (PubMed:23929945). Detection of retroviral reverse-transcribed DNA in the cytosol may be indirect and be mediated via interaction with PQBP1, which directly binds reverse-transcribed retroviral DNA (PubMed:26046437). Also detects the presence of DNA from bacteria, such as M.tuberculosis (PubMed:26048138). cGAMP can be transferred from producing cells to neighboring cells through gap junctions, leading to promote TMEM173/STING activation and convey immune response to connecting cells (PubMed:24077100). cGAMP can also be transferred between cells by virtue of packaging within viral particles contributing to IFN-induction in newly infected cells in a cGAS-independent but TMEM173/STING-dependent manner (PubMed:26229115). In addition to antiviral activity, also involved in the response to cellular stresses, such as senescence, DNA damage or genome instability (PubMed:28738408, PubMed:28759889). Acts as a regulator of cellular senescence by binding to cytosolic chromatin fragments that are present in senescent cells, leading to trigger type-I interferon production via TMEM173/STING and promote cellular senescence (By similarity). Also involved in the inflammatory response to genome instability and double-stranded DNA breaks: acts by localizing to micronuclei arising from genome instability (PubMed:28738408, PubMed:28759889). Micronuclei, which as frequently found in cancer cells, consist of chromatin surrounded by its own nuclear membrane: following breakdown of the micronuclear envelope, a process associated with chromothripsis, CGAS binds self-DNA exposed to the cytosol, leading to cGAMP synthesis and subsequent activation of TMEM173/STING and type-I interferon production (PubMed:28738408, PubMed:28759889). Acts as a suppressor of DNA repair in response to DNA damage: translocates to the nucleus following dephosphorylation at Tyr-215 and inhibits homologous recombination repair by interacting with PARP1, the CGAS-PARP1 interaction leading to impede the formation of the PARP1-TIMELESS complex (PubMed:30356214).[UniProtKB/Swiss-Prot Function]
Locus ID 115004
MW 60
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...