CDC14A (NM_033312) Human 3' UTR Clone

CAT#: SC200514

3' UTR clone of CDC14 cell division cycle 14 homolog A (S. cerevisiae) (CDC14A) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CDC14A (NM_033312) Human 3' UTR Clone
Vector pMirTarget
Synonyms cdc14; DFNB32; DFNB35; DFNB105; hCDC14
ACCN NM_033312
Insert Size 111 bp
Sequence Data
>SC200514 3’UTR clone of NM_033312
The sequence shown below is from the reference sequence of NM_033312. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAATTTAATAGTGCCAAGGAAGCCTTCTGAGCGATGCCTTCCCTCTGTGCTGTGAAACTGTCTATGCAC
TACATTCTGCTAGCTCCTCTTCAAGTAAACGCCAAGTCACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033312.3
Synonyms cdc14; DFNB32; DFNB35; DFNB105; hCDC14
Summary The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. It is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, suggesting a role in cell cycle control. This protein has been shown to interact with, and dephosphorylate tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splicing of this gene results in several transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Locus ID 8556
MW 4.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...