POLE2 (NM_002692) Human 3' UTR Clone

CAT#: SC200500

3' UTR clone of polymerase (DNA directed) epsilon 2 (p59 subunit) (POLE2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name POLE2 (NM_002692) Human 3' UTR Clone
Vector pMirTarget
Synonyms DPE2
ACCN NM_002692
Insert Size 127 bp
Sequence Data
>SC200500 3’UTR clone of NM_002692
The sequence shown below is from the reference sequence of NM_002692. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTAGAAGATAGCAAACTTCAAGGCTTTTGAGATTCTTAAAGATCATCTGAAGAAAATTCATCAGTTTTC
TGCTTAACTCTATATCTTATGTGATTCTGATATTACAATAAAATTATGGTAAACTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002692.4
Synonyms DPE2
Summary DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Locus ID 5427
MW 5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...