IRF7 (NM_004031) Human 3' UTR Clone

CAT#: SC200486

3' UTR clone of interferon regulatory factor 7 (IRF7) transcript variant d for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IRF7 (NM_004031) Human 3' UTR Clone
Vector pMirTarget
Synonyms IMD39; IRF-7; IRF-7H; IRF7A; IRF7B; IRF7C; IRF7H
ACCN NM_004031
Insert Size 120 bp
Sequence Data
>SC200486 3’UTR clone of NM_004031
The sequence shown below is from the reference sequence of NM_004031. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCCTTATGGAGCTGGAGCAGCCCGCCTAGAACCCAGTCTAATGAGAACTCCAGAAAGCTGGAGCAGCC
CACCTAGAGCTGGCCGCGGCCGCCCAGTCTAATAAAAAGAACTCCAGAACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004031.4
Synonyms IMD39; IRF-7; IRF-7H; IRF7A; IRF7B; IRF7C; IRF7H
Summary IRF7 encodes interferon regulatory factor 7, a member of the interferon regulatory transcription factor (IRF) family. IRF7 has been shown to play a role in the transcriptional activation of virus-inducible cellular genes, including interferon beta chain genes. Inducible expression of IRF7 is largely restricted to lymphoid tissue. Multiple IRF7 transcript variants have been identified, although the functional consequences of these have not yet been established. [provided by RefSeq, Jul 2008]
Locus ID 3665
MW 4.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...