POLD1 (NM_002691) Human 3' UTR Clone

CAT#: SC200482

3' UTR clone of polymerase (DNA directed) delta 1 catalytic subunit 125kDa (POLD1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name POLD1 (NM_002691) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDC2; CRCS10; MDPL; POLD
ACCN NM_002691
Insert Size 97 bp
Sequence Data
>SC200482 3’UTR clone of NM_002691
The sequence shown below is from the reference sequence of NM_002691. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCGGACCCCCTGGACCTGAGGCCTGGTGACCTTGCAAGCATCCCATGGGGCGGGGGCGGGACCAGGGA
GAATTAATAAAGTTCTGGACTTTTGCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002691.4
Synonyms CDC2; CRCS10; MDPL; POLD
Summary This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]
Locus ID 5424
MW 3.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...