COX11 (NM_001162861) Human 3' UTR Clone

CAT#: SC200451

3' UTR clone of COX11 homolog cytochrome c oxidase assembly protein (yeast) (COX11) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name COX11 (NM_001162861) Human 3' UTR Clone
Vector pMirTarget
Synonyms COX11P
ACCN NM_001162861
Insert Size 118 bp
Sequence Data
>SC200451 3’UTR clone of NM_001162861
The sequence shown below is from the reference sequence of NM_001162861. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTTCAAAGCTGCACAGAGTCTACGTTTTAGAGAGTTGGCACCTTTGATGTGGTAGTGAGCTGATCATCC
ACTTTCTTCTAAAATAAAGAGAAGAAAATGGCCAGTAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001162861.2
Synonyms COX11P
Summary Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be a heme A biosynthetic enzyme involved in COX formation, according to the yeast mutant studies. However, the studies in Rhodobacter sphaeroides suggest that this gene is not required for heme A biosynthesis, but required for stable formation of the Cu(B) and magnesium centers of COX. This human protein is predicted to contain a transmembrane domain localized in the mitochondrial inner membrane. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene has been found on chromosome 6. [provided by RefSeq, Jun 2009]
Locus ID 1353
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...