NDUFA11 (NM_175614) Human 3' UTR Clone

CAT#: SC200436

3' UTR clone of NADH dehydrogenase (ubiquinone) 1 alpha subcomplex11 14.7kDa (NDUFA11) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFA11 (NM_175614) Human 3' UTR Clone
Vector pMirTarget
Synonyms B14.7; CI-B14.7; MC1DN14
ACCN NM_175614
Insert Size 97 bp
Sequence Data
>SC200436 3’UTR clone of NM_175614
The sequence shown below is from the reference sequence of NM_175614. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGGAGGTGTTTGCAAAACCCAAGGTGTGAGCCCTGTGCCTGCCGGGACCTCCAGCCTGCAGAATGCGT
CCAGAAATAAATTCTGTGTCTGTGTGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_175614.5
Synonyms B14.7; CI-B14.7; MC1DN14
Summary This gene encodes a subunit of the membrane-bound mitochondrial complex I. Complex I is composed of numerous subunits and functions as the NADH-ubiquinol reductase of the mitochondrial electron transport chain. Mutations in this gene are associated with severe mitochondrial complex I deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
Locus ID 126328
MW 3.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...