PPM1B (NM_001033556) Human 3' UTR Clone

CAT#: SC200417

3' UTR clone of protein phosphatase 1B (formerly 2C) magnesium-dependent beta isoform (PPM1B) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PPM1B (NM_001033556) Human 3' UTR Clone
Vector pMirTarget
Synonyms PP2C-beta-X; PP2CB; PP2CBETA; PPC2BETAX
ACCN NM_001033556
Insert Size 115 bp
Sequence Data
>SC200417 3’UTR clone of NM_001033556
The sequence shown below is from the reference sequence of NM_001033556. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGGTTGAAGGTAAGACAAATGCTTTTTAAAAATATAGACAGGCCAGGCACGGTAGCTCATGCCTGTAA
TCCTAGCACTTTTGTCGCCTGGGCGACACACCAAGGCTCTGTCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001033556.1
Synonyms PP2C-beta-X; PP2CB; PP2CBETA; PPC2BETAX
Summary The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to cause cell-growth arrest or cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional transcript variants have been described, but currently do not represent full-length sequences. [provided by RefSeq, Jul 2008]
Locus ID 5495
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...