SH2B2 (NM_020979) Human 3' UTR Clone

CAT#: SC200402

3' UTR clone of SH2B adaptor protein 2 (SH2B2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SH2B2 (NM_020979) Human 3' UTR Clone
Vector pMirTarget
Synonyms APS
ACCN NM_020979
Insert Size 111 bp
Sequence Data
>SC200402 3’UTR clone of NM_020979
The sequence shown below is from the reference sequence of NM_020979. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCGTGGAGAACCAGTACTCCTTCTACTAGCCCGCGGCGCCGCCCGGGTGGGACACGCCAAGCTCTTCA
GTGAAGACACGATGTTATTAAAAGCCTGTTTTAGGGACTGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_020979.5
Synonyms APS
Summary The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
Locus ID 10603
MW 4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...