NDUFV1 (NM_007103) Human 3' UTR Clone

CAT#: SC200397

3' UTR clone of NADH dehydrogenase (ubiquinone) flavoprotein 1 51kDa (NDUFV1) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFV1 (NM_007103) Human 3' UTR Clone
Vector pMirTarget
Synonyms CI-51K; CI51KD; MC1DN4; UQOR1
ACCN NM_007103
Insert Size 126 bp
Sequence Data
>SC200397 3’UTR clone of NM_007103
The sequence shown below is from the reference sequence of NM_007103. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCATCAGGCCCGGCAGGCTGCCTCTTAGCCCACCACCCTGGCCTGCTGTCCTGCGTCTATCCATGTG
GAATGCTGGACAATAAAGCGAGTGCTGCCCACCCTCCAGCTGCCGCTGCTGTGACTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007103.4
Synonyms CI-51K; CI51KD; MC1DN4; UQOR1
Summary The mitochondrial respiratory chain provides energy to cells via oxidative phosphorylation and consists of four membrane-bound electron-transporting protein complexes (I-IV) and an ATP synthase (complex V). This gene encodes a 51 kDa subunit of the NADH:ubiquinone oxidoreductase complex I; a large complex with at least 45 nuclear and mitochondrial encoded subunits that liberates electrons from NADH and channels them to ubiquinone. This subunit carries the NADH-binding site as well as flavin mononucleotide (FMN)- and Fe-S-biding sites. Defects in complex I are a common cause of mitochondrial dysfunction; a syndrome that occurs in approximately 1 in 10,000 live births. Mitochondrial complex I deficiency is linked to myopathies, encephalomyopathies, and neurodegenerative disorders such as Parkinson's disease and Leigh syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Locus ID 4723
MW 4.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...