STXBP2 (NM_006949) Human 3' UTR Clone

CAT#: SC200392

3' UTR clone of syntaxin binding protein 2 (STXBP2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name STXBP2 (NM_006949) Human 3' UTR Clone
Vector pMirTarget
Synonyms FHL5; Hunc18b; MUNC18-2; pp10122; UNC18-2; UNC18B
ACCN NM_006949
Insert Size 93 bp
Sequence Data
>SC200392 3’UTR clone of NM_006949
The sequence shown below is from the reference sequence of NM_006949. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAAGCTGGAGGACATTGCCCTGCCCTGACCCCTGGCCCCGCCCCCTACCCCTCCCTTTCCAGAGAAA
TAAACTCTTCCCGTCGCTCTGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006949.4
Synonyms FHL5; Hunc18b; MUNC18-2; pp10122; UNC18-2; UNC18B
Summary This gene encodes a member of the STXBP/unc-18/SEC1 family. The encoded protein is involved in intracellular trafficking, control of SNARE (soluble NSF attachment protein receptor) complex assembly, and the release of cytotoxic granules by natural killer cells. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2013]
Locus ID 6813
MW 3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...