ACSM3 (NM_202000) Human 3' UTR Clone

CAT#: SC200386

3' UTR clone of acyl-CoA synthetase medium-chain family member 3 (ACSM3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ACSM3 (NM_202000) Human 3' UTR Clone
Vector pMirTarget
Synonyms SA; SAH
ACCN NM_202000
Insert Size 93 bp
Sequence Data
>SC200386 3’UTR clone of NM_202000
The sequence shown below is from the reference sequence of NM_202000. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTACCCCCATATAAACTTTCTTTGTTATGATGGTGATTCCATTTTACTTCCATGATACTTTAATTTTTA
TAAATATGTGAAAATGATTAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_202000.3
Synonyms SA; SAH
Summary Has medium-chain fatty acid:CoA ligase activity with broad substrate specificity (in vitro). Acts on acids from C(4) to C(11) and on the corresponding 3-hydroxy- and 2,3- or 3,4-unsaturated acids (in vitro) (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 6296
MW 3.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...