KIF22 (NM_007317) Human 3' UTR Clone

CAT#: SC200291

3' UTR clone of kinesin family member 22 (KIF22) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KIF22 (NM_007317) Human 3' UTR Clone
Vector pMirTarget
Synonyms A-328A3.2; KID; KNSL4; OBP; OBP-1; OBP-2; SEMDJL2
ACCN NM_007317
Insert Size 104 bp
Sequence Data
>SC200291 3’UTR clone of NM_007317
The sequence shown below is from the reference sequence of NM_007317. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCGCCGGCCAGCGCTGTGGCGCCTCCTGACCGTCGTCTCCTCACTCCGCCTTTTCAAATTTTTGTATA
ACCCCGTGTTGTGTAAATACAGTTTTTGCTCCGGT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007317.3
Synonyms A-328A3.2; KID; KNSL4; OBP; OBP-1; OBP-2; SEMDJL2
Summary The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C-terminal half of this protein has been shown to bind DNA. Studies with the Xenopus homolog suggests its essential role in metaphase chromosome alignment and maintenance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Locus ID 3835
MW 3.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...