Plexin A4 (PLXNA4) (NM_181775) Human 3' UTR Clone

CAT#: SC200280

3' UTR clone of plexin A4 (PLXNA4) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Plexin A4 (PLXNA4) (NM_181775) Human 3' UTR Clone
Vector pMirTarget
Synonyms FAYV2820; PLEXA4; PLXNA4A; PLXNA4B; PRO34003
ACCN NM_181775
Insert Size 84 bp
Sequence Data
>SC200280 3’UTR clone of NM_181775
The sequence shown below is from the reference sequence of NM_181775. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCCTAAATGTACCTGGGAATTCTTCCTAAAATTACTCTGGAAATTTGAATCCACTTTAACTAAAAATA
AATATTCATAGCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181775.4
Synonyms FAYV2820; PLEXA4; PLXNA4A; PLXNA4B; PRO34003
Summary Coreceptor for SEMA3A. Necessary for signaling by class 3 semaphorins and subsequent remodeling of the cytoskeleton. Plays a role in axon guidance in the developing nervous system. Class 3 semaphorins bind to a complex composed of a neuropilin and a plexin. The plexin modulates the affinity of the complex for specific semaphorins, and its cytoplasmic domain is required for the activation of down-stream signaling events in the cytoplasm (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 91584
MW 3.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...