ETFB (NM_001985) Human 3' UTR Clone

CAT#: SC200267

3' UTR clone of electron-transfer-flavoprotein beta polypeptide (ETFB) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ETFB (NM_001985) Human 3' UTR Clone
Vector pMirTarget
Synonyms FP585; MADD
ACCN NM_001985
Insert Size 72 bp
Sequence Data
>SC200267 3’UTR clone of NM_001985
The sequence shown below is from the reference sequence of NM_001985. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCAAGCTGAAGGAGATTGGGCGGATTTGAGCCCCTCCCAGAGATGGCAATAAAACTGACTCTCAACAT
CTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001985.3
Synonyms FP585; MADD
Summary This gene encodes electron-transfer-flavoprotein, beta polypeptide, which shuttles electrons between primary flavoprotein dehydrogenases involved in mitochondrial fatty acid and amino acid catabolism and the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase. The gene deficiencies have been implicated in type II glutaricaciduria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 2109
MW 2.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...