NDUFV2 (NM_021074) Human 3' UTR Clone

CAT#: SC200266

3' UTR clone of NADH dehydrogenase (ubiquinone) flavoprotein 2 24kDa (NDUFV2) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFV2 (NM_021074) Human 3' UTR Clone
Vector pMirTarget
Synonyms CI-24k; MC1DN7
ACCN NM_021074
Insert Size 92 bp
Sequence Data
>SC200266 3’UTR clone of NM_021074
The sequence shown below is from the reference sequence of NM_021074. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTGGATTTGGTGTACAAGCAGGCCTTTAATTTATATTGAACTGTAAATATGTCACTAGAGAAATAAAA
TATGGACTTCCAATCTACGTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021074.5
Synonyms CI-24k; MC1DN7
Summary The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes the 24 kDa subunit of complex I, and is involved in electron transfer. Mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A non-transcribed pseudogene of this locus is found on chromosome 19. [provided by RefSeq, Oct 2009]
Locus ID 4729
MW 3.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...