PNK (PNKP) (NM_007254) Human 3' UTR Clone

CAT#: SC200261

3' UTR clone of polynucleotide kinase 3'-phosphatase (PNKP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PNK (PNKP) (NM_007254) Human 3' UTR Clone
Vector pMirTarget
Synonyms AOA4; CMT2B2; EIEE10; MCSZ; PNK
ACCN NM_007254
Insert Size 74 bp
Sequence Data
>SC200261 3’UTR clone of NM_007254
The sequence shown below is from the reference sequence of NM_007254. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGCTGTACTGCCAGTTCTCCGAGGGCTGAGCCCCGCCCAGCTCCCCTCCACAATAAACGCTGTTTCTC
CTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007254.4
Synonyms AOA4; CMT2B2; EIEE10; MCSZ; PNK
Summary This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.[provided by RefSeq, Sep 2010]
Locus ID 11284
MW 2.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...