MPS1 (RPS27) (NM_001030) Human 3' UTR Clone

CAT#: SC200255

3' UTR clone of ribosomal protein S27 (RPS27) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MPS1 (RPS27) (NM_001030) Human 3' UTR Clone
Vector pMirTarget
Synonyms DBA17; MPS-1; MPS1; S27
ACCN NM_001030
Insert Size 92 bp
Sequence Data
>SC200255 3’UTR clone of NM_001030
The sequence shown below is from the reference sequence of NM_001030. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGATGTTCCTTCAGGAGGAAGCAGCACTAAAAGCACTCTGAGTCAAGATGAGTGGGAAACCATCTCAAT
AAACACATTTTGGATAAATCCTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001030.6
Synonyms DBA17; MPS-1; MPS1; S27
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the S27e family of ribosomal proteins and component of the 40S subunit. The encoded protein contains a C4-type zinc finger domain that can bind to zinc and may bind to nucleic acid. Mutations in this gene have been identified in numerous melanoma patients and in at least one patient with Diamond-Blackfan anemia (DBA). Elevated expression of this gene has been observed in various human cancers. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2018]
Locus ID 6232
MW 3.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...