FOLR3 (NM_000804) Human 3' UTR Clone

CAT#: SC200225

3' UTR clone of folate receptor 3 (gamma) (FOLR3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FOLR3 (NM_000804) Human 3' UTR Clone
Vector pMirTarget
Synonyms FR-G; FR-gamma; FRgamma; gamma-hFR
ACCN NM_000804
Insert Size 91 bp
Sequence Data
>SC200225 3’UTR clone of NM_000804
The sequence shown below is from the reference sequence of NM_000804. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCCCGTCTCGTGGGATTATTGATTCCTGATCCAAGAAGGGTCCTCTGGGGTTCTTCCAACAACCTATT
CTAATAGACAAATCCACATGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000804.4
Synonyms FR-G; FR-gamma; FRgamma; gamma-hFR
Summary This gene encodes a member of the folate receptor (FOLR) family of proteins, which have a high affinity for folic acid and for several reduced folic acid derivatives, and mediate delivery of 5-methyltetrahydrofolate to the interior of cells. Expression of this gene may be elevated in ovarian and primary peritoneal carcinoma. This gene is present in a gene cluster on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Locus ID 2352
MW 3.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...