KCNQ2 (NM_172109) Human 3' UTR Clone

CAT#: SC200191

3' UTR clone of potassium voltage-gated channel KQT-like subfamily member 2 (KCNQ2) transcript variant 5 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KCNQ2 (NM_172109) Human 3' UTR Clone
Vector pMirTarget
Synonyms BFNC; DEE7; EBN; EBN1; ENB1; HNSPC; KCNA11; KV7.2
ACCN NM_172109
Insert Size 97 bp
Sequence Data
>SC200191 3’UTR clone of NM_172109
The sequence shown below is from the reference sequence of NM_172109. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTCATTTTTTATTTTCCATTTGTTCTTAAACCCCACTTTTTGTTGTTCATTATTTTGATTGATTTTTT
TTCTTTAAAATGTATTTTTCACAAAGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_172109.3
Synonyms BFNC; DEE7; EBN; EBN1; ENB1; HNSPC; KCNA11; KV7.2
Summary The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 3785
MW 4.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...